Construct sox3_dr8


Location in zv6: chr14:65092780-65093616
Forward primer: sox3dr72newF (GCTGTACACTGGGTCTTTGTCA)
Reverse primer: sox3dr72newR (ACAGATAAGTAGTTAAAGACCTTTATAG)
Enhancer name: sox3dr7+2
Promoter name: gata2
Assigned gene: sox3
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images