Construct sox3_dr7


Location in zv6: chr14:65085260-65085533
Forward primer: sox3dr8F (TCCTCCATTGAGTCTGTAG)
Reverse primer: sox3dr8R (CTGAAACTACATCACTTATC)
Assigned gene: sox3
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images