Construct sox11b_dr6


Location in zv6: chr20:42956838-42957822
Forward primer: sox11drB1f (GCTGAAAGCGCAAAATGACGCTT)
Reverse primer: sox11drB1r (TTGTAGGCTTTGCATGTGTCC)
Enhancer name: sox11b_dr6
Promoter name: gata2
Assigned gene: sox11b
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images