Construct sox11b_dr5


Location in zv6: chr20:42981802-42982562
Forward primer: 1drBf (GCTACCGTCCCAAACATGAGTAAAC)
Reverse primer: 1drBr (AATCATCAATTGTGCTTCGAAATCAG)
Enhancer name: sox11b_dr5
Promoter name: gata2
Assigned gene: sox11b
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images