Construct sox11b_dr2


Location in zv6: chr20:43171936-43172955
Forward primer: sox11drB2bF (AATGACACGTTACTTTTACCCTC)
Reverse primer: sox11drB2bR (ACAGTCAACAATGCCCATACAG)
Enhancer name: sox11drB2
Promoter name: gata2
Assigned gene: sox11b
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images