Construct sox11a_dr7


Location in zv7: chr17:23893616-23894663
Forward primer: sox11drA4f (TGCATGTTTAATGTCTTTGCCC)
Reverse primer: sox11drA4r (AGCCACTTTCTAAACAAGTAGTTGC)
Promoter name: gata2
Assigned gene: sox11
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images