Construct sox11a_dr6


Location in zv7: chr17:23896535-23897223
Forward primer: sox11drB1Af (ATGGTGGTTACAGCCTTGGG)
Reverse primer: sox11drB1Ar (AAAACCAGGACAGGAGGGAG)
Promoter name: gata2
Assigned gene: sox11a
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images