Construct sox11a_dr5


Location in zv6: chr17:30881718-30882255
Forward primer: 1drcF (CCGTCCACATTCTCCTTCCTT)
Reverse primer: 1drcR (TCTCTCTCCGAGGCATTTCATC)
Enhancer name: sox11a_dr5
Assigned gene: sox11a
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images