Construct sox11a_dr3


Location in zv6: chr17:31202806-31203445
Forward primer: sox11drA2F (TTTTGCAGTCGAAAGGGCTGA)
Reverse primer: sox11drA2R (GCACGTTTTGCAAGCTGGACC)
Enhancer name: sox11drA2
Promoter name: gata2
Assigned gene: sox11a
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images