Construct pax6b_dr8


Location in zv6: chr7:14305082-14306018
Forward primer: immp1lbF (TAACCAAAATGCACATCCTTAGA)
Reverse primer: immp1lbR (CTTTATGCAATTCTGTTTCAGC)
Enhancer name: drimmp1lB
Promoter name: gata2
Assigned gene: pax6b
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images