Construct pax6a_dr8


Location in zv6: chr25:17478948-17480257
Forward primer: immp1laF (ACAACTTCCTGTTGTAAAAATCC)
Reverse primer: immp1laR (TGTGCATTTGAATGACATAAGC)
Enhancer name: immp1lA
Promoter name: gata2
Assigned gene: pax6a
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images