Construct pax6a_dr6a


Location in zv6: chr25:17559430-17559724
Forward primer: drSIMOt1F (TGTACCAGAGCACAGATAATAG)
Reverse primer: drSIMOt1R (TTCAAGGCTACAGCTTCAT)
Assigned gene: pax6a
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images