Construct pax6a_dr1


Location in zv6: chr25:17695970-17697453
Forward primer: RCN1dr2F (ACAATGGCATAAAGTTCACCG)
Reverse primer: RCN1dr2R (TTTCACAAGCAACTTTAAAATACAG)
Enhancer name: drRCN1a2
Promoter name: gata2
Assigned gene: pax6a
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images