Construct hs_ATP11C/SOX3_hs8A


Location in hg18: chrX:138997808-138998036
Forward primer: SOX3h7F (TCTTCCCACAGGGCTCCATT)
Reverse primer: SOX3h7R (TGCAACCTACAAAAGCTGTC)
Enhancer name: SOX3h7
Promoter name: hsATP11C
Assigned gene: SOX3
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images