Construct SOX3_hs6


Location in hg18: chrX:139067274-139068034
Forward primer: SOX3hum11F (AGTAAGCCATTGAGAGGCCAGTC)
Reverse primer: SOX3hum11R (ATCCTCCGTGGTCCATTTGTTC)
Enhancer name: SOX3h11
Promoter name: gata2
Assigned gene: SOX3
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images