Construct SOX11_hs7


Location in hg18: chr2:5321866-5322773
Forward primer: SOX11hA4f (AGTCTAGCAAGCCATGGAACC)
Reverse primer: SOX11hA4r (CACAAATTAAGCCGATTCTTCAG)
Promoter name: gata2
Assigned gene: SOX11
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images