Construct SOX11_hs5


Location in hg18: chr2:5467548-5468060
Forward primer: 1hcF (CAGTTGTCAACGTATCCGTGC)
Reverse primer: 1h2R (tcATCGATTTTTTCTCCAAGGATTTTTCTG)
Assigned gene: SOX11
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images