Construct SOX11_hs3


Location in hg18: chr2:6130438-6132069
Forward primer: SOX11hA2f (GTGCTCAGGGTTTGCACCAGG)
Reverse primer: SOX11hA2r (GAACCATCAGCCCATTCGAGG)
Enhancer name: SOX11hA2
Promoter name: gata2
Assigned gene: SOX11
Reference: Navratilova P, Fredman D, Lenhard B, Becker TS: Regulatory divergence of the duplicated chromosomal loci sox11a/b by subpartitioning and sequence evolution of enhancers in zebrafish (submitted)

F0 Line Birthdate F0 sex Images