Construct PAX6_hs6


Location in hg18: chr11:31641933-31643460
Forward primer: simoEBf (CACCTGGAATATTTTGGCATTTTGG)
Reverse primer: simoEBr (TCCCTTTTGCTACAGGCATA)
Enhancer name: EB
Promoter name: gata2
Assigned gene: PAX6
Reference: Navratilova P, Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS: Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes. Dev Biol. 2009 Mar 15;327(2):526-40.

F0 Line Birthdate F0 sex Images